In addition to Weibo, there is also WeChat
Please pay attention

WeChat public account
Shulou
2026-02-08 Update From: SLTechnology News&Howtos shulou NAV: SLTechnology News&Howtos > Development >
Share
Shulou(Shulou.com)06/01 Report--
This article will explain in detail how to use perl scripts to generate reverse complementary sequences in batches. The editor thinks it is very practical, so I share it with you as a reference. I hope you can get something after reading this article.
Sometimes we need to get the reverse complementary sequence of the sequence, and we can use the script below to batch process the sequence.
Usage:
Perl fasta_Reverse_complementary.pl-fa input.fa-out out.fa
Input.fa is the input file, and out.fa is the reverse complementary sequence.
Enter the file format as shown below:
> bta-26a-2GGCUGUGGCUGGAUUCAAGUAAUCCAGGAUAGGCUGUUUCCAUCUGUGAGGCCUAUUCUUGAUUACUUGUUUCUGGAGGCAGCU > bta-18bCUUGUGUUAAGGUGCAUCUAGUGCAGUUAGUGAAGCAGCUCAGAAUCUACUGCCCUAAAUGCUCCUUCUGGCACA > bta-29aAUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUAGCACCAUCUGAAAUCGGUUAU > bta-7f-2UGUGGGAUGAGGUAGUAGAUUGUAUAGUUUUAGGGUCAUACCCCAUCUUGGAGAUAACUAUACAGUCUACUGUCUUUCCCACG
The code is as follows:
#! / usr/bin/perl-wuse strict;use Getopt::Long;use Config::General;use Bio::SeqIO;use Bio::Seq;my $version = "1.3" # # prepare parameters #- -# # GetOptionsmy% opts GetOptions (\% opts, "fa=s", "out=s", "h"); if (! defined ($opts {out}) | |! defined ($opts {fa}) | | defined ($opts {h}) {print "$opts {fa}",-format = > 'Fasta'); open (OUT, "> $opts {out}") | die "open file $opts {out} faild.\ n"; while (my $seq = $in- > next_seq () {my ($id,$sequence) = ($seq- > id,$seq- > id,$seq-) $sequence = & reverse_complement_IUPAC ($sequence); print OUT "> $id\ n$sequence\ n";} sub reverse_complement_IUPAC {my $dna = shift; # reverse the DNA sequence my $revcomp = reverse ($dna); # complement the reversed DNA sequence $revcomp = ~ tr/ABCDGHMNRSTUVWXYabcdghmnrstuvwxy/TVGHCDKNYSAABWXRtvghcdknysaabwxr/; return $revcomp;} sub reverse_complement {my $dna = shift # reverse the DNA sequence my $revcomp = reverse ($dna); # complement the reversed DNA sequence $revcomp = ~ tr/ACGTacgt/TGCAtgca/; return $revcomp } this is the end of the article on "how to use perl scripts to generate reverse complementary sequences in batches". I hope the above content can be of some help to you, so that you can learn more knowledge. if you think the article is good, please share it for more people to see.
Welcome to subscribe "Shulou Technology Information " to get latest news, interesting things and hot topics in the IT industry, and controls the hottest and latest Internet news, technology news and IT industry trends.
Views: 0
*The comments in the above article only represent the author's personal views and do not represent the views and positions of this website. If you have more insights, please feel free to contribute and share.

The market share of Chrome browser on the desktop has exceeded 70%, and users are complaining about
The world's first 2nm mobile chip: Samsung Exynos 2600 is ready for mass production.According to a r
A US federal judge has ruled that Google can keep its Chrome browser, but it will be prohibited from
Continue with the installation of the previous hadoop.First, install zookooper1. Decompress zookoope





About us Contact us Product review car news thenatureplanet
More Form oMedia: AutoTimes. Bestcoffee. SL News. Jarebook. Coffee Hunters. Sundaily. Modezone. NNB. Coffee. Game News. FrontStreet. GGAMEN
© 2024 shulou.com SLNews company. All rights reserved.